Guideline recommendations and antimicrobial resistance: the need for a change.

antimicrobial resistance has become a global burden of inappropriate use of antimicrobials is an important contributing factor. Any decisions on the selection of antibiotic use should take into account the effect on antimicrobial resistance. The purpose of this study was to assess the extent to which the guidelines prescribe antibiotic resistance patterns have been considered when making recommendations for the five syndrome is a very common infection.

We used Medline search engines equipped with extensive use of the web to identify the empirical treatment guidelines for community-acquired pneumonia, urinary tract infections, acute otitis media, rhinosinusitis and pharyngitis. We collect microbiology and resistance patterns and categories of patterns of discrete identified. We assess the extent to which the recommendation was considered a resistance, in addition to safety and efficacy, as recommended antibiotics.

We identified 135 guidelines, which reported a total of 251 recommendations. The majority (103/135, 79%) come from developed countries. Community-acquired pneumonia is mostly represented syndrome (51, 39%). In only 16 (6.4%) recommendation, the selection of empiric antibiotics discussed in terms of endurance and certain microbiological data. In a further 69 (27.5%) recommendations were made in relation to the reference resistance, but the effort was not consistent. In syndrome, 12 of resistance patterns with implications on the recommendation observed. 50% to 75% of the recommendations are not trying to recommendation set in the context of these patterns.

There is consistent evidence that the guidelines for the use of empirical antibiotic resistance is not routinely consider in their recommendations. Decision makers must analyze and report on the extent to which local resistance patterns to enable better decision-making. the abundance of viruses in soil can range from below detection limit in the desert heat for more than 1 billion per gram in wetlands. Abundance seems strongly influenced by water availability and temperature, but the lack of standards of information makes it difficult to cross-study analysis.

Guideline recommendations and antimicrobial resistance: the need for a change.
Guideline recommendations and antimicrobial resistance: the need for a change.

Soil diversity of viruses is very underrated and undersampled, despite the measures currently higher viral richness to the ground than the aquatic ecosystem. Both morphometric analysis and metagenomic have raised questions about the prevalence of nontailed, ssDNA viruses in soil. Land complex and important for terrestrial biodiversity and human civilization, but the impact of viral activity in the soil ecosystem services are poorly understood. Information from aquatic systems and medical microbiology virus shows potential effect on nutrient cycling, food web interactions, gene transfer, and other key processes in the soil, very little empirical data available. To understand virome ground, still a lot of work.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

WAC Polyclonal Antibody

30135-100ul 100ul
EUR 252.00

WAC Polyclonal Antibody

30135-50ul 50ul
EUR 187.00

Polyclonal WAC Antibody

APR06814G 0.1 mg
EUR 659.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WAC . This antibody is tested and proven to work in the following applications:

WAC cloning plasmid

CSB-CL861133HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 633
  • Sequence: atgtctttaacatctgatgcgtcatccccaagatcatatgtttctccaagaataagcacacctcaaactaacacagtccctatcaaacctttgatcagtactcctcctgtttcatcacagccaaaggttagtactccagtagttaagcaaggaccagtgtcacagtcagccacaca
  • Show more
Description: A cloning plasmid for the WAC gene.

WAC cloning plasmid

CSB-CL861133HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1950
  • Sequence: atggtaatgtatgcgaggaaacagcagagactcagtgatggctgtcacgaccggaggggggactcgcagccttaccaggcacttaagtattcatcgaagagtcaccccagtagcggtgatcacagacatgaaaagatgcgagacgccggagatccttcaccaccaaataaaatgt
  • Show more
Description: A cloning plasmid for the WAC gene.

WAC Rabbit pAb

A17703-100ul 100 ul
EUR 308.00

WAC Rabbit pAb

A17703-200ul 200 ul
EUR 459.00

WAC Rabbit pAb

A17703-20ul 20 ul
EUR 183.00

WAC Rabbit pAb

A17703-50ul 50 ul
EUR 223.00

Anti-WAC antibody

STJ119746 100 µl
EUR 277.00
Description: The protein encoded by this gene contains a WW domain, which is a protein module found in a wide range of signaling proteins. This domain mediates protein-protein interactions and binds proteins containing short linear peptide motifs that are proline-rich or contain at least one proline. This gene product shares 94% sequence identity with the WAC protein in mouse, however, its exact function is not known. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]

WAC Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WAC. Recognizes WAC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

WAC Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WAC. Recognizes WAC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

WAC Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WAC. Recognizes WAC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA


ELI-17505m 96 Tests
EUR 865.00


ELI-28258h 96 Tests
EUR 824.00

WAC Polyclonal Conjugated Antibody

C30135 100ul
EUR 397.00

Human WAC shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse WAC shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

WAC Recombinant Protein (Human)

RP034486 100 ug Ask for price

WAC Recombinant Protein (Human)

RP034489 100 ug Ask for price

WAC Recombinant Protein (Mouse)

RP185087 100 ug Ask for price

WAC Recombinant Protein (Mouse)

RP185090 100 ug Ask for price

Enterobacteria phage T4 Fibritin (wac)

  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 67.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Enterobacteria phage T4 Fibritin(wac) expressed in E.coli

Wac ORF Vector (Mouse) (pORF)

ORF061697 1.0 ug DNA
EUR 506.00

Wac ORF Vector (Mouse) (pORF)

ORF061698 1.0 ug DNA
EUR 506.00

WAC ORF Vector (Human) (pORF)

ORF011496 1.0 ug DNA
EUR 95.00

WAC ORF Vector (Human) (pORF)

ORF011497 1.0 ug DNA
EUR 95.00

WAC sgRNA CRISPR Lentivector set (Human)

K2624401 3 x 1.0 ug
EUR 339.00

Wac sgRNA CRISPR Lentivector set (Mouse)

K4566401 3 x 1.0 ug
EUR 339.00

WAC sgRNA CRISPR Lentivector (Human) (Target 1)

K2624402 1.0 ug DNA
EUR 154.00

WAC sgRNA CRISPR Lentivector (Human) (Target 2)

K2624403 1.0 ug DNA
EUR 154.00

WAC sgRNA CRISPR Lentivector (Human) (Target 3)

K2624404 1.0 ug DNA
EUR 154.00

Wac sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4566402 1.0 ug DNA
EUR 154.00

Wac sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4566403 1.0 ug DNA
EUR 154.00

Wac sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4566404 1.0 ug DNA
EUR 154.00

WAC Protein Vector (Mouse) (pPB-C-His)

PV246786 500 ng
EUR 603.00

WAC Protein Vector (Mouse) (pPB-N-His)

PV246787 500 ng
EUR 603.00

WAC Protein Vector (Mouse) (pPM-C-HA)

PV246788 500 ng
EUR 603.00

WAC Protein Vector (Mouse) (pPM-C-His)

PV246789 500 ng
EUR 603.00

WAC Protein Vector (Mouse) (pPB-C-His)

PV246790 500 ng
EUR 603.00

WAC Protein Vector (Mouse) (pPB-N-His)

PV246791 500 ng
EUR 603.00

WAC Protein Vector (Mouse) (pPM-C-HA)

PV246792 500 ng
EUR 603.00

WAC Protein Vector (Mouse) (pPM-C-His)

PV246793 500 ng
EUR 603.00

WAC Protein Vector (Human) (pPB-C-His)

PV045981 500 ng
EUR 329.00

WAC Protein Vector (Human) (pPB-N-His)

PV045982 500 ng
EUR 329.00

WAC Protein Vector (Human) (pPM-C-HA)

PV045983 500 ng
EUR 329.00

WAC Protein Vector (Human) (pPM-C-His)

PV045984 500 ng
EUR 329.00

WAC Protein Vector (Human) (pPB-C-His)

PV045985 500 ng
EUR 329.00

WAC Protein Vector (Human) (pPB-N-His)

PV045986 500 ng
EUR 329.00

WAC Protein Vector (Human) (pPM-C-HA)

PV045987 500 ng
EUR 329.00

WAC Protein Vector (Human) (pPM-C-His)

PV045988 500 ng
EUR 329.00

Wac 3'UTR Luciferase Stable Cell Line

TU122179 1.0 ml Ask for price

WAC 3'UTR GFP Stable Cell Line

TU078352 1.0 ml
EUR 2333.00

Wac 3'UTR GFP Stable Cell Line

TU172179 1.0 ml Ask for price

WAC 3'UTR Luciferase Stable Cell Line

TU028352 1.0 ml
EUR 2333.00

WAC Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV716727 1.0 ug DNA
EUR 316.00

WAC Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV716731 1.0 ug DNA
EUR 316.00

WAC Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV716732 1.0 ug DNA
EUR 316.00

WW Domain-Containing Adapter Protein With Coiled-Coil (WAC) Antibody

abx034415-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

WW Domain-Containing Adapter Protein With Coiled-Coil (WAC) Antibody

abx034415-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

WW Domain-Containing Adapter Protein With Coiled-Coil (WAC) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

WAC sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2624405 3 x 1.0 ug
EUR 376.00

Wac sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4566405 3 x 1.0 ug
EUR 376.00

WW Domain-Containing Adapter Protein With Coiled-Coil (WAC) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

WW Domain-Containing Adapter Protein With Coiled-Coil (WAC) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

WW Domain-Containing Adapter Protein With Coiled-Coil (WAC) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

WAC Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV716728 1.0 ug DNA
EUR 316.00

WAC Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV716729 1.0 ug DNA
EUR 374.00

WAC Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV716730 1.0 ug DNA
EUR 374.00

WAC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2624406 1.0 ug DNA
EUR 167.00

WAC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2624407 1.0 ug DNA
EUR 167.00

WAC sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2624408 1.0 ug DNA
EUR 167.00

Wac sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4566406 1.0 ug DNA
EUR 167.00

Wac sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4566407 1.0 ug DNA
EUR 167.00

Wac sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4566408 1.0 ug DNA
EUR 167.00

Leave a Comment

Your email address will not be published. Required fields are marked *

Scroll to Top